# Two sides — Tumble Cards

## Card

- **Number:** TUM-001
- **Name:** Two sides
- **World:** TUM
- **Type:** knowledge
- **Language:** en
- **ULID:** 01M4K1QHAFPYV2E28NZ37QCQB4
- **DNA:** gtctgtcgagctaagcacccttgatattctcgcctccgcaaaacggacagcgacgttacccatt
- **Version:** db56dd7b (2026-10-10)
- **Verify:** https://tumblecard.com/verify/?dna=gtctgtcgagctaagcacccttgatattctcgcctccgcaaaacggacagcgacgttacccatt&v=db56dd7b

## Front

*The first thing about me*

I have two sides. Turn me over — everything you can do with me lives on my back.

## Back

- **lead:** This is my other side. My front says what I am; my back says what you can do. No menu, no page behind a page — just me, turned.
- **items:** [{"term":"Front","def":"What I am: a name, a picture, a few lines. Enough to decide whether to turn me."},{"term":"Back","def":"What you can do: read on, buy, download, or walk into my world."},{"term":"The strip","def":"Edition, world and 'turn' — the same on every card, so you always know where you are."}]

<!-- cta:begin -->
- **cta:** {"card":"01M4K1QHAF61G932SK2M0F3QPV","label":"Next: my DNA"}
<!-- cta:einde -->

## Body

I am a card with two sides: a front that says what I am and a back that says what you can do. Every card in this system is built the same way.

## Relations

- tp:systems: topic
- [Tumble Cards](https://catalog.tumblecard.com/tttgtgtatcttgcgcgaaacgtatggcttaaatacgcataaacggacagcgacgttacccatt/): world
- [image](https://tumblecard.com/tum-two-sides-gtctgtcgagctaagcacccttgatattctcgcctccgcaaaacggacagcgacgttacccatt/assets/cards/tum-hero-two-sides.webp): card illustration

## Source

- **Canonical:** https://tumblecard.com/tum-two-sides-gtctgtcgagctaagcacccttgatattctcgcctccgcaaaacggacagcgacgttacccatt/
- **All cards on this site:** https://tumblecard.com/llms.txt

The canonical HTML page and card.json are the authoritative representations.