# Me, on paper — Tumble Cards

## Card

- **Number:** TUM-010
- **Name:** Me, on paper
- **World:** TUM
- **Type:** knowledge
- **Language:** en
- **ULID:** 01M4K2GFW1V7736MFS567PG7JA
- **DNA:** tcgctatgatatccacttgcaggcgattcggaactgcaggaaacggacagcgaggaatttgaac
- **Version:** 231a45cc (2026-10-10)
- **Verify:** https://tumblecard.com/verify/?dna=tcgctatgatatccacttgcaggcgattcggaactgcaggaaacggacagcgaggaatttgaac&v=231a45cc

## Front

*Print me, cut me, keep me*

I print as a real card: two sides, my DNA
as a code, and a path back to the living me.

## Back

- **lead:** 'PDF' on my back gives you me on paper: front and back, trading-card size. The paper carries no buttons — buttons are the living layer — only one QR code with my DNA. Scan it and you land on the living me, wherever I am placed by then.
- **items:** [{"term":"No buttons","def":"Paper does not click. It carries what lasts: words, picture, number, DNA."},{"term":"One QR","def":"The code holds my DNA, not an address. Addresses change; DNA does not."},{"term":"Trading-card size","def":"63 by 88 millimetres. Fits a sleeve, a pocket, a binder."}]

<!-- cta:begin -->
- **cta:** {"card":"01M4K1QHAFPYV2E28NZ37QCQB4","label":"Back to the start: my two sides"}
<!-- cta:einde -->

## Body

'PDF' on my back gives you me on paper: front and back, trading-card size.

## Relations

- tp:systems: topic
- [Tumble Cards](https://catalog.tumblecard.com/tttgtgtatcttgcgcgaaacgtatggcttaaatacgcataaacggacagcgacgttacccatt/): world
- [image](https://tumblecard.com/tum-on-paper-tcgctatgatatccacttgcaggcgattcggaactgcaggaaacggacagcgaggaatttgaac/assets/cards/tum-hero-paper.webp): card illustration

## Source

- **Canonical:** https://tumblecard.com/tum-on-paper-tcgctatgatatccacttgcaggcgattcggaactgcaggaaacggacagcgaggaatttgaac/
- **All cards on this site:** https://tumblecard.com/llms.txt

The canonical HTML page and card.json are the authoritative representations.