{
  "kind": "card",
  "schema_version": 1,
  "id": "01M4K2GFW1V7736MFS567PG7JA",
  "dna": "tcgctatgatatccacttgcaggcgattcggaactgcaggaaacggacagcgaggaatttgaac",
  "number": "TUM-010",
  "world": "TUM",
  "world_id": "01M4K1QHAFZVPDZ6C0DKMZ0CCK",
  "family": "tum-elementen",
  "type": "knowledge",
  "lang": "en",
  "title": "Me, on paper",
  "name": "Me, on paper",
  "subtitle": "Print me, cut me, keep me",
  "lede": "I print as a real card: two sides, my DNA\nas a code, and a path back to the living me.",
  "summary": "'PDF' on my back gives you me on paper: front and back, trading-card size. The paper carries no buttons — buttons are the living layer — only one QR code with my DNA. Scan it and you land on the living me, wherever I am placed by then.",
  "seo_title": "Me, on paper — Tumble Cards",
  "back": {
    "lead": "'PDF' on my back gives you me on paper: front and back, trading-card size. The paper carries no buttons — buttons are the living layer — only one QR code with my DNA. Scan it and you land on the living me, wherever I am placed by then.",
    "items": [
      {
        "term": "No buttons",
        "def": "Paper does not click. It carries what lasts: words, picture, number, DNA."
      },
      {
        "term": "One QR",
        "def": "The code holds my DNA, not an address. Addresses change; DNA does not."
      },
      {
        "term": "Trading-card size",
        "def": "63 by 88 millimetres. Fits a sleeve, a pocket, a binder."
      }
    ],
    "cta": {
      "card": "01M4K1QHAFPYV2E28NZ37QCQB4",
      "label": "Back to the start: my two sides"
    }
  },
  "content": {
    "body_markdown": "'PDF' on my back gives you me on paper: front and back, trading-card size."
  },
  "codon": "frost-birch-shore",
  "tier": "basic",
  "edition": "Edition 1",
  "relations": [
    {
      "type": "topic",
      "id": "tp:systems"
    }
  ],
  "representations": {
    "html": "https://tumblecard.com/tum-on-paper-tcgctatgatatccacttgcaggcgattcggaactgcaggaaacggacagcgaggaatttgaac/",
    "markdown": "https://tumblecard.com/tum-on-paper-tcgctatgatatccacttgcaggcgattcggaactgcaggaaacggacagcgaggaatttgaac/card.md",
    "machine_index": "https://tumblecard.com/llms.txt",
    "print": "https://tumblecard.com/tum-on-paper-tcgctatgatatccacttgcaggcgattcggaactgcaggaaacggacagcgaggaatttgaac/werkkaart.pdf",
    "image": "https://tumblecard.com/tum-on-paper-tcgctatgatatccacttgcaggcgattcggaactgcaggaaacggacagcgaggaatttgaac/assets/cards/tum-hero-paper.webp"
  },
  "canonical": "https://tumblecard.com/tum-on-paper-tcgctatgatatccacttgcaggcgattcggaactgcaggaaacggacagcgaggaatttgaac/",
  "catalog": "https://catalog.tumblecard.com/tcgctatgatatccacttgcaggcgattcggaactgcaggaaacggacagcgaggaatttgaac/",
  "verify": "https://tumblecard.com/verify/?dna=tcgctatgatatccacttgcaggcgattcggaactgcaggaaacggacagcgaggaatttgaac&v=231a45cc",
  "actions": [
    {
      "type": "open",
      "target": "https://tumblecard.com/tum-on-paper-tcgctatgatatccacttgcaggcgattcggaactgcaggaaacggacagcgaggaatttgaac/"
    },
    {
      "type": "verify",
      "target": "https://tumblecard.com/verify/?dna=tcgctatgatatccacttgcaggcgattcggaactgcaggaaacggacagcgaggaatttgaac&v=231a45cc"
    },
    {
      "type": "related",
      "target": "https://tumblecard.com/tum-two-sides-gtctgtcgagctaagcacccttgatattctcgcctccgcaaaacggacagcgacgttacccatt/",
      "name": "Back to the start: my two sides"
    },
    {
      "type": "print",
      "target": "https://tumblecard.com/tum-on-paper-tcgctatgatatccacttgcaggcgattcggaactgcaggaaacggacagcgaggaatttgaac/werkkaart.pdf",
      "format": "tradingcard 63x88 mm, A4 duplex"
    }
  ],
  "created_at": "2026-10-10T14:15:57.572Z",
  "updated_at": "2026-10-10T14:15:57.572Z",
  "content_hash": "43de6dc868fd6812a07b48949b17f43e35f6e8d81b2a57d8e3768ff80822599c",
  "content_version": "231a45cc"
}