# My world — Tumble Cards

## Card

- **Number:** TUM-004
- **Name:** My world
- **World:** TUM
- **Type:** knowledge
- **Language:** en
- **ULID:** 01M4K2GFW1TN7G50DP5E0HK159
- **DNA:** tccccattaaaggaacgtcgaggtgaacacgcgacagggcaaacggacagcgaggaatttgaac
- **Version:** 1eeff5e3 (2026-10-10)
- **Verify:** https://tumblecard.com/verify/?dna=tccccattaaaggaacgtcgaggtgaacacgcgacagggcaaacggacagcgaggaatttgaac&v=1eeff5e3

## Front

*Where I get my meaning*

I belong to a world. It gives me my colours,
my letters and the company I keep.

## Back

- **lead:** A world is not a website. It is a context: a maker's universe with its own colours, type, language and tone. I am from Tumble Cards; my neighbours are from Eo Ena, Vic Boomer or Stoutenburger. We can stand on the same page and still look like ourselves.
- **items:** [{"term":"Skin","def":"My world decides how I look. The anatomy is shared; the skin is mine."},{"term":"Language","def":"Each card speaks the language of her world, wherever she appears."},{"term":"Family","def":"Inside a world I belong to a family: the cards that are about the same thing."}]

<!-- cta:begin -->
- **cta:** {"card":"01M4K2GFW1HRHEH9ADQFN2B56H","label":"Next: my stack"}
<!-- cta:einde -->

## Body

A world is not a website.

## Relations

- tp:systems: topic
- [Tumble Cards](https://catalog.tumblecard.com/tttgtgtatcttgcgcgaaacgtatggcttaaatacgcataaacggacagcgacgttacccatt/): world
- [image](https://tumblecard.com/tum-my-world-tccccattaaaggaacgtcgaggtgaacacgcgacagggcaaacggacagcgaggaatttgaac/assets/cards/tum-hero-world.webp): card illustration

## Source

- **Canonical:** https://tumblecard.com/tum-my-world-tccccattaaaggaacgtcgaggtgaacacgcgacagggcaaacggacagcgaggaatttgaac/
- **All cards on this site:** https://tumblecard.com/llms.txt

The canonical HTML page and card.json are the authoritative representations.