# My stack — Tumble Cards

## Card

- **Number:** TUM-005
- **Name:** My stack
- **World:** TUM
- **Type:** knowledge
- **Language:** en
- **ULID:** 01M4K2GFW1HRHEH9ADQFN2B56H
- **DNA:** gatgagagtggaggcccatcgtgttgggagccgccatcacaaacggacagcgaggaatttgaac
- **Version:** 8bb47319 (2026-10-10)
- **Verify:** https://tumblecard.com/verify/?dna=gatgagagtggaggcccatcgtgttgggagccgccatcacaaacggacagcgaggaatttgaac&v=8bb47319

## Front

*When I have more to say*

I am one card. When my story is longer,
I carry a stack of bigger cards behind me.

## Back

- **lead:** A trading card fits a few lines. For the full story there is a stack: larger cards, in order, with a cover. I stay the small card you met; the stack is where I go on. Every card in it has her own number.
- **items:** [{"term":"Stack card","def":"That is me: the small card that opens the stack."},{"term":"Members","def":"The bigger cards inside, each with her own number, read in order."},{"term":"Order","def":"A stack carries order. A family does not; a world does not. Only the stack."}]

<!-- cta:begin -->
- **cta:** {"stack":"01M4K2GFW1WMB5NXQP74TXAG8F","label":"Open my stack"}
<!-- cta:einde -->

## Body

A trading card fits a few lines.

## Relations

- tp:systems: topic
- [Tumble Cards](https://catalog.tumblecard.com/tttgtgtatcttgcgcgaaacgtatggcttaaatacgcataaacggacagcgacgttacccatt/): world
- [image](https://tumblecard.com/tum-my-stack-gatgagagtggaggcccatcgtgttgggagccgccatcacaaacggacagcgaggaatttgaac/assets/cards/tum-hero-stack.webp): card illustration

## Source

- **Canonical:** https://tumblecard.com/tum-my-stack-gatgagagtggaggcccatcgtgttgggagccgccatcacaaacggacagcgaggaatttgaac/
- **All cards on this site:** https://tumblecard.com/llms.txt

The canonical HTML page and card.json are the authoritative representations.