# Cover — My stack — Tumble Cards

## Card

- **Number:** TUM-011
- **Name:** My stack
- **World:** TUM
- **Type:** knowledge-card
- **Language:** en
- **ULID:** 01M4K2GFW1MG8AQ3S8FJVANWXG
- **DNA:** ggcaacaagggtgattaggacttagtcgggggttatgtaaaaacggacagcgaggaatttgaac
- **Version:** 9bd7a509 (2026-10-10)
- **Verify:** https://tumblecard.com/verify/?dna=ggcaacaagggtgattaggacttagtcgggggttatgtaaaaacggacagcgaggaatttgaac&v=9bd7a509

## Front

**Cover**

## Content

### Greeting

Two cards on what a stack is: why I exist, and what order means.

## Body

Member 1 of 3 of the stack **My stack** (TUM-005).

## Relations

- [My stack](https://tumblecard.com/stacks/tum-my-stack/stack.md): stack
- tp:systems: topic
- [Tumble Cards](https://catalog.tumblecard.com/tttgtgtatcttgcgcgaaacgtatggcttaaatacgcataaacggacagcgacgttacccatt/): world
- [image](https://tumblecard.com/tum-my-stack-cover-ggcaacaagggtgattaggacttagtcgggggttatgtaaaaacggacagcgaggaatttgaac/assets/cards/tum-hero-stack.webp): card illustration

## Source

- **Canonical:** https://tumblecard.com/stacks/tum-my-stack/
- **All cards on this site:** https://tumblecard.com/llms.txt

The canonical HTML page and card.json are the authoritative representations.