# What order means — My stack — Tumble Cards

## Card

- **Number:** TUM-013
- **Name:** My stack
- **World:** TUM
- **Type:** knowledge-card
- **Language:** en
- **ULID:** 01M4K2GFW18J0J4BBZPS05KRAM
- **DNA:** cacagaacagagagtcctttgtcgcaaaccgctgaccccaaaacggacagcgaggaatttgaac
- **Version:** 03d0c0a8 (2026-10-10)
- **Verify:** https://tumblecard.com/verify/?dna=cacagaacagagagtcctttgtcgcaaaccgctgaccccaaaacggacagcgaggaatttgaac&v=03d0c0a8

## Front

**What order means**

## Content

### Text

Most groups of cards have no order. A world is a context: her cards sit side by side and none comes first. A family groups cards that are about the same thing. A deck is a selection, laid out for a front door.

A stack is the one composition that carries order. Card 1 comes before card 2, because the story needs it to. The order lives on the stack, not on the cards: each member keeps her own number, and could be dealt elsewhere tomorrow.

So when you see '2 of 3' at the top of a card, that is where she sits in this stack. Her number — the one in the corner — is who she is.

## Body

Member 3 of 3 of the stack **My stack** (TUM-005).

## Relations

- [My stack](https://tumblecard.com/stacks/tum-my-stack/stack.md): stack
- tp:systems: topic
- [Tumble Cards](https://catalog.tumblecard.com/tttgtgtatcttgcgcgaaacgtatggcttaaatacgcataaacggacagcgacgttacccatt/): world

## Source

- **Canonical:** https://tumblecard.com/stacks/tum-my-stack/
- **All cards on this site:** https://tumblecard.com/llms.txt

The canonical HTML page and card.json are the authoritative representations.