{
  "kind": "card",
  "schema_version": 1,
  "id": "01M4K2GFW18J0J4BBZPS05KRAM",
  "dna": "cacagaacagagagtcctttgtcgcaaaccgctgaccccaaaacggacagcgaggaatttgaac",
  "number": "TUM-013",
  "world": "TUM",
  "world_id": "01M4K1QHAFZVPDZ6C0DKMZ0CCK",
  "family": "tum-elementen",
  "type": "knowledge-card",
  "lang": "en",
  "title": "What order means",
  "name": "My stack",
  "lede": "",
  "summary": "Most groups of cards have no order. A world is a context: her cards sit side by side and none comes first. A family groups cards that are about the same thing. A deck is a selection, laid out for a front door. A stack is the one composition that carries order. Card 1 comes before card 2, because the story needs it to.",
  "seo_title": "What order means — My stack — Tumble Cards",
  "content": {
    "text": "Most groups of cards have no order. A world is a context: her cards sit side by side and none comes first. A family groups cards that are about the same thing. A deck is a selection, laid out for a front door.\n\nA stack is the one composition that carries order. Card 1 comes before card 2, because the story needs it to. The order lives on the stack, not on the cards: each member keeps her own number, and could be dealt elsewhere tomorrow.\n\nSo when you see '2 of 3' at the top of a card, that is where she sits in this stack. Her number — the one in the corner — is who she is.",
    "body_markdown": "Member 3 of 3 of the stack **My stack** (TUM-005)."
  },
  "codon": "brook-stone-clay",
  "tier": "basic",
  "edition": "Edition 1",
  "parent_stack": {
    "title": "My stack",
    "url": "https://tumblecard.com/stacks/tum-my-stack/"
  },
  "relations": [
    {
      "type": "topic",
      "id": "tp:systems"
    }
  ],
  "representations": {
    "html": "https://tumblecard.com/stacks/tum-my-stack/",
    "markdown": "https://tumblecard.com/tum-my-stack-2-cacagaacagagagtcctttgtcgcaaaccgctgaccccaaaacggacagcgaggaatttgaac/card.md",
    "machine_index": "https://tumblecard.com/llms.txt",
    "print": "https://tumblecard.com/stacks/tum-my-stack/drukvel.pdf"
  },
  "canonical": "https://tumblecard.com/stacks/tum-my-stack/",
  "catalog": "https://catalog.tumblecard.com/tgccaccgccggttcgttcgatgcatcctccccaacaattaaacggacagcgaggaatttgaac/",
  "verify": "https://tumblecard.com/verify/?dna=cacagaacagagagtcctttgtcgcaaaccgctgaccccaaaacggacagcgaggaatttgaac&v=03d0c0a8",
  "actions": [
    {
      "type": "open",
      "target": "https://tumblecard.com/stacks/tum-my-stack/"
    },
    {
      "type": "verify",
      "target": "https://tumblecard.com/verify/?dna=cacagaacagagagtcctttgtcgcaaaccgctgaccccaaaacggacagcgaggaatttgaac&v=03d0c0a8"
    },
    {
      "type": "print",
      "target": "https://tumblecard.com/stacks/tum-my-stack/drukvel.pdf",
      "format": "jumbocard stack 126x176 mm, A4 duplex"
    }
  ],
  "created_at": "2026-10-10T14:15:58.784Z",
  "updated_at": "2026-10-10T14:15:58.784Z",
  "content_hash": "b6516f1df6d7be2171138eb80910620495fb5c8dfd45c8d4122bd8afbad2d7e9",
  "content_version": "03d0c0a8"
}