# Why I exist — My stack — Tumble Cards

## Card

- **Number:** TUM-012
- **Name:** My stack
- **World:** TUM
- **Type:** knowledge-card
- **Language:** en
- **ULID:** 01M4K2GFW1EQBQE0E8WRFP8SNY
- **DNA:** ctcctcctctctaaactagatgcgacttcgcacgcggttgaaacggacagcgaggaatttgaac
- **Version:** 2dfcd3a8 (2026-10-10)
- **Verify:** https://tumblecard.com/verify/?dna=ctcctcctctctaaactagatgcgacttcgcacgcggttgaaacggacagcgaggaatttgaac&v=2dfcd3a8

## Front

**Why I exist**

## Content

### Text

A trading card is small on purpose. She says one thing, well, and then she stops. That is her strength — and her limit. Some stories do not fit in four lines and a picture.

So the small card gets a stack. Not a page that scrolls on forever, but bigger cards, one after the other, with a cover in front. You read them the way you would read a short booklet: card by card, each one complete in itself.

The small card does not change. She stays what you met first; she just carries me behind her. That is why the stack bears her name: I am not a different thing, I am her story told at length.

## Body

Member 2 of 3 of the stack **My stack** (TUM-005).

## Relations

- [My stack](https://tumblecard.com/stacks/tum-my-stack/stack.md): stack
- tp:systems: topic
- [Tumble Cards](https://catalog.tumblecard.com/tttgtgtatcttgcgcgaaacgtatggcttaaatacgcataaacggacagcgacgttacccatt/): world

## Source

- **Canonical:** https://tumblecard.com/stacks/tum-my-stack/
- **All cards on this site:** https://tumblecard.com/llms.txt

The canonical HTML page and card.json are the authoritative representations.