{
  "kind": "card",
  "schema_version": 1,
  "id": "01M4K2GFW1EQBQE0E8WRFP8SNY",
  "dna": "ctcctcctctctaaactagatgcgacttcgcacgcggttgaaacggacagcgaggaatttgaac",
  "number": "TUM-012",
  "world": "TUM",
  "world_id": "01M4K1QHAFZVPDZ6C0DKMZ0CCK",
  "family": "tum-elementen",
  "type": "knowledge-card",
  "lang": "en",
  "title": "Why I exist",
  "name": "My stack",
  "lede": "",
  "summary": "A trading card is small on purpose. She says one thing, well, and then she stops. That is her strength — and her limit. Some stories do not fit in four lines and a picture. So the small card gets a stack. Not a page that scrolls on forever, but bigger cards, one after the other, with a cover in front.",
  "seo_title": "Why I exist — My stack — Tumble Cards",
  "content": {
    "text": "A trading card is small on purpose. She says one thing, well, and then she stops. That is her strength — and her limit. Some stories do not fit in four lines and a picture.\n\nSo the small card gets a stack. Not a page that scrolls on forever, but bigger cards, one after the other, with a cover in front. You read them the way you would read a short booklet: card by card, each one complete in itself.\n\nThe small card does not change. She stays what you met first; she just carries me behind her. That is why the stack bears her name: I am not a different thing, I am her story told at length.",
    "body_markdown": "Member 2 of 3 of the stack **My stack** (TUM-005)."
  },
  "codon": "gold-gold-gold",
  "tier": "basic",
  "edition": "Edition 1",
  "parent_stack": {
    "title": "My stack",
    "url": "https://tumblecard.com/stacks/tum-my-stack/"
  },
  "relations": [
    {
      "type": "topic",
      "id": "tp:systems"
    }
  ],
  "representations": {
    "html": "https://tumblecard.com/stacks/tum-my-stack/",
    "markdown": "https://tumblecard.com/tum-my-stack-1-ctcctcctctctaaactagatgcgacttcgcacgcggttgaaacggacagcgaggaatttgaac/card.md",
    "machine_index": "https://tumblecard.com/llms.txt",
    "print": "https://tumblecard.com/stacks/tum-my-stack/drukvel.pdf"
  },
  "canonical": "https://tumblecard.com/stacks/tum-my-stack/",
  "catalog": "https://catalog.tumblecard.com/tgccaccgccggttcgttcgatgcatcctccccaacaattaaacggacagcgaggaatttgaac/",
  "verify": "https://tumblecard.com/verify/?dna=ctcctcctctctaaactagatgcgacttcgcacgcggttgaaacggacagcgaggaatttgaac&v=2dfcd3a8",
  "actions": [
    {
      "type": "open",
      "target": "https://tumblecard.com/stacks/tum-my-stack/"
    },
    {
      "type": "verify",
      "target": "https://tumblecard.com/verify/?dna=ctcctcctctctaaactagatgcgacttcgcacgcggttgaaacggacagcgaggaatttgaac&v=2dfcd3a8"
    },
    {
      "type": "print",
      "target": "https://tumblecard.com/stacks/tum-my-stack/drukvel.pdf",
      "format": "jumbocard stack 126x176 mm, A4 duplex"
    }
  ],
  "created_at": "2026-10-10T14:15:58.856Z",
  "updated_at": "2026-10-10T14:15:58.856Z",
  "content_hash": "bacfad90bc55ac213cdfb90f5245daa25b44d7eceaa0edc13ce340ca3d34ab99",
  "content_version": "2dfcd3a8"
}