# My seal — Tumble Cards

## Card

- **Number:** TUM-006
- **Name:** My seal
- **World:** TUM
- **Type:** knowledge
- **Language:** en
- **ULID:** 01M4K2GFW1G28BVYR8YCFVTGAF
- **DNA:** gaaagcaagttcttgtaagattatacttgttccaaccattaaacggacagcgaggaatttgaac
- **Version:** abce2c18 (2026-10-10)
- **Verify:** https://tumblecard.com/verify/?dna=gaaagcaagttcttgtaagattatacttgttccaaccattaaacggacagcgaggaatttgaac&v=abce2c18

## Front

*Why you can trust what I say*

Everything I say is signed. Change a letter
and my seal breaks — that is the point.

## Back

- **lead:** My maker signs me. The signature covers my words, my picture and my number, and lives in a public manifest. 'Integrity check' on my back compares the card you see with the card that was signed. A new version gets a new seal; the old one stays on record.
- **items:** [{"term":"Version","def":"When I change, I get a new version. The earlier me is still there to read."},{"term":"Integrity check","def":"One click shows whether I am still the card my maker signed."},{"term":"Edition","def":"Many cards are printed and placed at once; that batch is an edition."}]

<!-- cta:begin -->
- **cta:** {"card":"01M4K2GFW19VX4A056EY0TQ1R8","label":"Next: my compass"}
<!-- cta:einde -->

## Body

My maker signs me.

## Relations

- tp:systems: topic
- [Tumble Cards](https://catalog.tumblecard.com/tttgtgtatcttgcgcgaaacgtatggcttaaatacgcataaacggacagcgacgttacccatt/): world
- [image](https://tumblecard.com/tum-my-seal-gaaagcaagttcttgtaagattatacttgttccaaccattaaacggacagcgaggaatttgaac/assets/cards/tum-hero-seal.webp): card illustration

## Source

- **Canonical:** https://tumblecard.com/tum-my-seal-gaaagcaagttcttgtaagattatacttgttccaaccattaaacggacagcgaggaatttgaac/
- **All cards on this site:** https://tumblecard.com/llms.txt

The canonical HTML page and card.json are the authoritative representations.