# My number — Tumble Cards

## Card

- **Number:** TUM-003
- **Name:** My number
- **World:** TUM
- **Type:** knowledge
- **Language:** en
- **ULID:** 01M4K2GFW0C4G4FNNH8P0Q1CNR
- **DNA:** cgacagaacacttccggtaccaccgaacctaagtaggtgaaaacggacagcgaggaatttgaaa
- **Version:** c687e02d (2026-10-10)
- **Verify:** https://tumblecard.com/verify/?dna=cgacagaacacttccggtaccaccgaacctaagtaggtgaaaacggacagcgaggaatttgaaa&v=c687e02d

## Front

*Look at my top right corner*

TUM-003. That is my number, and no card
will ever carry it after me.

## Back

- **lead:** Every card gets a number when she is born: a world code and a count. Mine is TUM-003. Numbers are never reused — not even when a card is withdrawn. A gap stays a gap.
- **items:** [{"term":"World code","def":"The three letters say which world I belong to. TUM is Tumble Cards."},{"term":"Count","def":"The third card of my world. Not the third on a page: the third ever made."},{"term":"Not a position","def":"When I sit in a stack as 2 of 4, that is where I sit. My number stays mine."}]

<!-- cta:begin -->
- **cta:** {"card":"01M4K2GFW1TN7G50DP5E0HK159","label":"Next: my world"}
<!-- cta:einde -->

## Body

Every card gets a number when she is born: a world code and a count.

## Relations

- tp:systems: topic
- [Tumble Cards](https://catalog.tumblecard.com/tttgtgtatcttgcgcgaaacgtatggcttaaatacgcataaacggacagcgacgttacccatt/): world
- [image](https://tumblecard.com/tum-my-number-cgacagaacacttccggtaccaccgaacctaagtaggtgaaaacggacagcgaggaatttgaaa/assets/cards/tum-hero-number.webp): card illustration

## Source

- **Canonical:** https://tumblecard.com/tum-my-number-cgacagaacacttccggtaccaccgaacctaagtaggtgaaaacggacagcgaggaatttgaaa/
- **All cards on this site:** https://tumblecard.com/llms.txt

The canonical HTML page and card.json are the authoritative representations.