# My living side — Tumble Cards

## Card

- **Number:** TUM-008
- **Name:** My living side
- **World:** TUM
- **Type:** knowledge
- **Language:** en
- **ULID:** 01M4K2GFW1P53F97C5K0HVMNW0
- **DNA:** gtaccacgttcagctcgaccgcgaagatgtggccctgaaaaaacggacagcgaggaatttgaac
- **Version:** eeefbcfc (2026-10-10)
- **Verify:** https://tumblecard.com/verify/?dna=gtaccacgttcagctcgaccgcgaagatgtggccctgaaaaaacggacagcgaggaatttgaac&v=eeefbcfc

## Front

*What changes without changing me*

My buttons can change tonight. My words,
my picture and my seal will not.

## Back

- **lead:** The actions on my back — read on, buy, download, visit — are not part of me. They are a living layer that my maker can switch on, off or rewrite without touching the signed card. That is how I can be for sale today and sold out tomorrow, and still be the same card.
- **items:** [{"term":"Call to action","def":"A door on my back. Doors can move; walls cannot."},{"term":"Buy","def":"Buying happens in a stack of cards too — no cart, no account. Just me, turned, and a few steps."},{"term":"Sold out","def":"A door closes; the card stays."}]

<!-- cta:begin -->
- **cta:** {"card":"01M4K2GFW15D6C3T6YKBPG6QA7","label":"Next: me, for your AI"}
<!-- cta:einde -->

## Body

The actions on my back — read on, buy, download, visit — are not part of me.

## Relations

- tp:systems: topic
- [Tumble Cards](https://catalog.tumblecard.com/tttgtgtatcttgcgcgaaacgtatggcttaaatacgcataaacggacagcgacgttacccatt/): world
- [image](https://tumblecard.com/tum-my-living-side-gtaccacgttcagctcgaccgcgaagatgtggccctgaaaaaacggacagcgaggaatttgaac/assets/cards/tum-hero-living.webp): card illustration

## Source

- **Canonical:** https://tumblecard.com/tum-my-living-side-gtaccacgttcagctcgaccgcgaagatgtggccctgaaaaaacggacagcgaggaatttgaac/
- **All cards on this site:** https://tumblecard.com/llms.txt

The canonical HTML page and card.json are the authoritative representations.