{
  "kind": "card",
  "schema_version": 1,
  "id": "01M4K2GFW1P53F97C5K0HVMNW0",
  "dna": "gtaccacgttcagctcgaccgcgaagatgtggccctgaaaaaacggacagcgaggaatttgaac",
  "number": "TUM-008",
  "world": "TUM",
  "world_id": "01M4K1QHAFZVPDZ6C0DKMZ0CCK",
  "family": "tum-elementen",
  "type": "knowledge",
  "lang": "en",
  "title": "My living side",
  "name": "My living side",
  "subtitle": "What changes without changing me",
  "lede": "My buttons can change tonight. My words,\nmy picture and my seal will not.",
  "summary": "The actions on my back — read on, buy, download, visit — are not part of me. They are a living layer that my maker can switch on, off or rewrite without touching the signed card. That is how I can be for sale today and sold out tomorrow, and still be the same card.",
  "seo_title": "My living side — Tumble Cards",
  "back": {
    "lead": "The actions on my back — read on, buy, download, visit — are not part of me. They are a living layer that my maker can switch on, off or rewrite without touching the signed card. That is how I can be for sale today and sold out tomorrow, and still be the same card.",
    "items": [
      {
        "term": "Call to action",
        "def": "A door on my back. Doors can move; walls cannot."
      },
      {
        "term": "Buy",
        "def": "Buying happens in a stack of cards too — no cart, no account. Just me, turned, and a few steps."
      },
      {
        "term": "Sold out",
        "def": "A door closes; the card stays."
      }
    ],
    "cta": {
      "card": "01M4K2GFW15D6C3T6YKBPG6QA7",
      "label": "Next: me, for your AI"
    }
  },
  "content": {
    "body_markdown": "The actions on my back — read on, buy, download, visit — are not part of me."
  },
  "codon": "reed-salt-comb",
  "tier": "basic",
  "edition": "Edition 1",
  "relations": [
    {
      "type": "topic",
      "id": "tp:systems"
    }
  ],
  "representations": {
    "html": "https://tumblecard.com/tum-my-living-side-gtaccacgttcagctcgaccgcgaagatgtggccctgaaaaaacggacagcgaggaatttgaac/",
    "markdown": "https://tumblecard.com/tum-my-living-side-gtaccacgttcagctcgaccgcgaagatgtggccctgaaaaaacggacagcgaggaatttgaac/card.md",
    "machine_index": "https://tumblecard.com/llms.txt",
    "print": "https://tumblecard.com/tum-my-living-side-gtaccacgttcagctcgaccgcgaagatgtggccctgaaaaaacggacagcgaggaatttgaac/werkkaart.pdf",
    "image": "https://tumblecard.com/tum-my-living-side-gtaccacgttcagctcgaccgcgaagatgtggccctgaaaaaacggacagcgaggaatttgaac/assets/cards/tum-hero-living.webp"
  },
  "canonical": "https://tumblecard.com/tum-my-living-side-gtaccacgttcagctcgaccgcgaagatgtggccctgaaaaaacggacagcgaggaatttgaac/",
  "catalog": "https://catalog.tumblecard.com/gtaccacgttcagctcgaccgcgaagatgtggccctgaaaaaacggacagcgaggaatttgaac/",
  "verify": "https://tumblecard.com/verify/?dna=gtaccacgttcagctcgaccgcgaagatgtggccctgaaaaaacggacagcgaggaatttgaac&v=eeefbcfc",
  "actions": [
    {
      "type": "open",
      "target": "https://tumblecard.com/tum-my-living-side-gtaccacgttcagctcgaccgcgaagatgtggccctgaaaaaacggacagcgaggaatttgaac/"
    },
    {
      "type": "verify",
      "target": "https://tumblecard.com/verify/?dna=gtaccacgttcagctcgaccgcgaagatgtggccctgaaaaaacggacagcgaggaatttgaac&v=eeefbcfc"
    },
    {
      "type": "related",
      "target": "https://tumblecard.com/tum-for-your-ai-aggtcatataactggatctggcggtgtcaaatcctccactaaacggacagcgaggaatttgaac/",
      "name": "Next: me, for your AI"
    },
    {
      "type": "print",
      "target": "https://tumblecard.com/tum-my-living-side-gtaccacgttcagctcgaccgcgaagatgtggccctgaaaaaacggacagcgaggaatttgaac/werkkaart.pdf",
      "format": "tradingcard 63x88 mm, A4 duplex"
    }
  ],
  "created_at": "2026-10-10T14:15:58.237Z",
  "updated_at": "2026-10-10T14:15:58.237Z",
  "content_hash": "540746df48b81674dcd11da1adadddbd9a0b13582dc2f048d7eefad074be04e9",
  "content_version": "eeefbcfc"
}