# My DNA — Tumble Cards

## Card

- **Number:** TUM-002
- **Name:** My DNA
- **World:** TUM
- **Type:** knowledge
- **Language:** en
- **ULID:** 01M4K1QHAF61G932SK2M0F3QPV
- **DNA:** ataacgaagcacgagtatatacccaaaattactctgtcgtaaacggacagcgacgttacccatt
- **Version:** 274df487 (2026-10-10)
- **Verify:** https://tumblecard.com/verify/?dna=ataacgaagcacgagtatatacccaaaattactctgtcgtaaacggacagcgacgttacccatt&v=274df487

## Front

*How you find me again*

Three words are my name. They come from my DNA, and nobody else has them.

## Back

- **lead:** Look at the bottom of this side: three words and sixty-four letters. That is me, whatever address I live at. Print me, scan me, type me — you land on the living me.
- **items:** [{"term":"Codons","def":"My three words, read from my DNA. The name I go by."},{"term":"DNA route","def":"dna.tumblecard.com followed by my DNA always leads to me, even when I move house."},{"term":"Paper","def":"The QR on my printed self carries the same DNA. Paper and screen are one card."}]

<!-- cta:begin -->
- **cta:** {"card":"01M4K2GFW0C4G4FNNH8P0Q1CNR","label":"Next: my number"}
<!-- cta:einde -->

## Body

Every card carries a DNA of sixty-four letters, unique and permanent, and a name of three words read from it. The DNA route at dna.tumblecard.com always leads to the living card.

## Relations

- tp:systems: topic
- [Tumble Cards](https://catalog.tumblecard.com/tttgtgtatcttgcgcgaaacgtatggcttaaatacgcataaacggacagcgacgttacccatt/): world
- [image](https://tumblecard.com/tum-my-dna-ataacgaagcacgagtatatacccaaaattactctgtcgtaaacggacagcgacgttacccatt/assets/cards/tum-hero-dna.webp): card illustration

## Source

- **Canonical:** https://tumblecard.com/tum-my-dna-ataacgaagcacgagtatatacccaaaattactctgtcgtaaacggacagcgacgttacccatt/
- **All cards on this site:** https://tumblecard.com/llms.txt

The canonical HTML page and card.json are the authoritative representations.