# My compass — Tumble Cards

## Card

- **Number:** TUM-007
- **Name:** My compass
- **World:** TUM
- **Type:** knowledge
- **Language:** en
- **ULID:** 01M4K2GFW19VX4A056EY0TQ1R8
- **DNA:** catgttggcaccaaaaggcgctctgaacgggtgactaagaaaacggacagcgaggaatttgaac
- **Version:** ff70bdf3 (2026-10-10)
- **Verify:** https://tumblecard.com/verify/?dna=catgttggcaccaaaaggcgctctgaacgggtgactaagaaaacggacagcgaggaatttgaac&v=ff70bdf3

## Front

*How you find your way back*

No menu, no map. I carry a compass:
back to where you came from, always.

## Back

- **lead:** A website has a menu and a map. I have neither. My compass remembers the path you walked — card by card — and 'Back' takes you one step up it. No path lives in my address; the compass keeps it for you, on this device only.
- **items:** [{"term":"Back","def":"One step back along your own path, not a page I chose for you."},{"term":"The traveller","def":"Your path is yours. It is kept with you, never with me."},{"term":"No sitemap","def":"You do not need the whole map to walk one road."}]

<!-- cta:begin -->
- **cta:** {"card":"01M4K2GFW1P53F97C5K0HVMNW0","label":"Next: my living side"}
<!-- cta:einde -->

## Body

A website has a menu and a map.

## Relations

- tp:systems: topic
- [Tumble Cards](https://catalog.tumblecard.com/tttgtgtatcttgcgcgaaacgtatggcttaaatacgcataaacggacagcgacgttacccatt/): world
- [image](https://tumblecard.com/tum-my-compass-catgttggcaccaaaaggcgctctgaacgggtgactaagaaaacggacagcgaggaatttgaac/assets/cards/tum-hero-compass.webp): card illustration

## Source

- **Canonical:** https://tumblecard.com/tum-my-compass-catgttggcaccaaaaggcgctctgaacgggtgactaagaaaacggacagcgaggaatttgaac/
- **All cards on this site:** https://tumblecard.com/llms.txt

The canonical HTML page and card.json are the authoritative representations.