# Me, for your AI — Tumble Cards

## Card

- **Number:** TUM-009
- **Name:** Me, for your AI
- **World:** TUM
- **Type:** knowledge
- **Language:** en
- **ULID:** 01M4K2GFW15D6C3T6YKBPG6QA7
- **DNA:** aggtcatataactggatctggcggtgtcaaatcctccactaaacggacagcgaggaatttgaac
- **Version:** d62d21d6 (2026-10-10)
- **Verify:** https://tumblecard.com/verify/?dna=aggtcatataactggatctggcggtgtcaaatcctccactaaacggacagcgaggaatttgaac&v=d62d21d6

## Front

*The same card, written for a machine*

Give me to your assistant. I come as one
plain file: no menus, no guessing.

## Back

- **lead:** Next to 'PDF' on my back sits 'AI'. It hands your assistant one plain text file with everything I am — words, number, DNA, maker, version — in the order a machine reads best. Nothing in it tells your assistant what to do. You get the card, not my wishes.
- **items:** [{"term":"card.md","def":"One file per card, or one per stack. Readable by any assistant."},{"term":"Same card","def":"What is in the file is what is on the card. Two forms, one card."},{"term":"Your assistant","def":"I do not choose your AI, and I send no instructions along."}]

<!-- cta:begin -->
- **cta:** {"card":"01M4K2GFW1V7736MFS567PG7JA","label":"Next: me, on paper"}
<!-- cta:einde -->

## Body

Next to 'PDF' on my back sits 'AI'.

## Relations

- tp:systems: topic
- [Tumble Cards](https://catalog.tumblecard.com/tttgtgtatcttgcgcgaaacgtatggcttaaatacgcataaacggacagcgacgttacccatt/): world
- [image](https://tumblecard.com/tum-for-your-ai-aggtcatataactggatctggcggtgtcaaatcctccactaaacggacagcgaggaatttgaac/assets/cards/tum-hero-ai.webp): card illustration

## Source

- **Canonical:** https://tumblecard.com/tum-for-your-ai-aggtcatataactggatctggcggtgtcaaatcctccactaaacggacagcgaggaatttgaac/
- **All cards on this site:** https://tumblecard.com/llms.txt

The canonical HTML page and card.json are the authoritative representations.