# My stack

Two bigger cards on what a stack is, told by the stack herself: why I exist, and what order means.

## Stack

- **ULID:** 01M4K2GFW1WMB5NXQP74TXAG8F
- **DNA:** tgccaccgccggttcgttcgatgcatcctccccaacaattaaacggacagcgaggaatttgaac
- **Verify:** https://tumblecard.com/verify/?dna=tgccaccgccggttcgttcgatgcatcctccccaacaattaaacggacagcgaggaatttgaac
- **Cards:** 3

## 1. TUM-011 · Cover

### Card

- **Number:** TUM-011
- **Name:** My stack
- **World:** TUM
- **Type:** knowledge-card
- **Language:** en
- **ULID:** 01M4K2GFW1MG8AQ3S8FJVANWXG
- **DNA:** ggcaacaagggtgattaggacttagtcgggggttatgtaaaaacggacagcgaggaatttgaac
- **Version:** 9bd7a509 (2026-10-10)
- **Verify:** https://tumblecard.com/verify/?dna=ggcaacaagggtgattaggacttagtcgggggttatgtaaaaacggacagcgaggaatttgaac&v=9bd7a509

### Front

**Cover**

### Content

#### Greeting

Two cards on what a stack is: why I exist, and what order means.

### Body

Member 1 of 3 of the stack **My stack** (TUM-005).

### Relations

- [My stack](https://tumblecard.com/stacks/tum-my-stack/stack.md): stack
- tp:systems: topic
- [Tumble Cards](https://catalog.tumblecard.com/tttgtgtatcttgcgcgaaacgtatggcttaaatacgcataaacggacagcgacgttacccatt/): world
- [image](https://tumblecard.com/tum-my-stack-cover-ggcaacaagggtgattaggacttagtcgggggttatgtaaaaacggacagcgaggaatttgaac/assets/cards/tum-hero-stack.webp): card illustration

## 2. TUM-012 · Why I exist

### Card

- **Number:** TUM-012
- **Name:** My stack
- **World:** TUM
- **Type:** knowledge-card
- **Language:** en
- **ULID:** 01M4K2GFW1EQBQE0E8WRFP8SNY
- **DNA:** ctcctcctctctaaactagatgcgacttcgcacgcggttgaaacggacagcgaggaatttgaac
- **Version:** 2dfcd3a8 (2026-10-10)
- **Verify:** https://tumblecard.com/verify/?dna=ctcctcctctctaaactagatgcgacttcgcacgcggttgaaacggacagcgaggaatttgaac&v=2dfcd3a8

### Front

**Why I exist**

### Content

#### Text

A trading card is small on purpose. She says one thing, well, and then she stops. That is her strength — and her limit. Some stories do not fit in four lines and a picture.

So the small card gets a stack. Not a page that scrolls on forever, but bigger cards, one after the other, with a cover in front. You read them the way you would read a short booklet: card by card, each one complete in itself.

The small card does not change. She stays what you met first; she just carries me behind her. That is why the stack bears her name: I am not a different thing, I am her story told at length.

### Body

Member 2 of 3 of the stack **My stack** (TUM-005).

### Relations

- [My stack](https://tumblecard.com/stacks/tum-my-stack/stack.md): stack
- tp:systems: topic
- [Tumble Cards](https://catalog.tumblecard.com/tttgtgtatcttgcgcgaaacgtatggcttaaatacgcataaacggacagcgacgttacccatt/): world

## 3. TUM-013 · What order means

### Card

- **Number:** TUM-013
- **Name:** My stack
- **World:** TUM
- **Type:** knowledge-card
- **Language:** en
- **ULID:** 01M4K2GFW18J0J4BBZPS05KRAM
- **DNA:** cacagaacagagagtcctttgtcgcaaaccgctgaccccaaaacggacagcgaggaatttgaac
- **Version:** 03d0c0a8 (2026-10-10)
- **Verify:** https://tumblecard.com/verify/?dna=cacagaacagagagtcctttgtcgcaaaccgctgaccccaaaacggacagcgaggaatttgaac&v=03d0c0a8

### Front

**What order means**

### Content

#### Text

Most groups of cards have no order. A world is a context: her cards sit side by side and none comes first. A family groups cards that are about the same thing. A deck is a selection, laid out for a front door.

A stack is the one composition that carries order. Card 1 comes before card 2, because the story needs it to. The order lives on the stack, not on the cards: each member keeps her own number, and could be dealt elsewhere tomorrow.

So when you see '2 of 3' at the top of a card, that is where she sits in this stack. Her number — the one in the corner — is who she is.

### Body

Member 3 of 3 of the stack **My stack** (TUM-005).

### Relations

- [My stack](https://tumblecard.com/stacks/tum-my-stack/stack.md): stack
- tp:systems: topic
- [Tumble Cards](https://catalog.tumblecard.com/tttgtgtatcttgcgcgaaacgtatggcttaaatacgcataaacggacagcgacgttacccatt/): world


## Source

- **Canonical:** https://tumblecard.com/stacks/tum-my-stack/
- **All cards on this site:** https://tumblecard.com/llms.txt

The canonical HTML page and stack.json are the authoritative representations.