# Tumble Cards — Eo Ena

## Card

- **Number:** EOE-002
- **Name:** Tumble Cards
- **World:** EOE
- **Type:** knowledge
- **Language:** en
- **ULID:** 01KY6Y2D8CZRY9TE72HH42VRGV
- **DNA:** tttgattagctcatgatgaggatacagaagtctgagacgtaaacgcttgatctgacatccaata
- **Version:** cd0f7db7 (2026-09-27)
- **Verify:** https://eoena.com/verify/?dna=tttgattagctcatgatgaggatacagaagtctgagacgtaaacgcttgatctgacatccaata&v=cd0f7db7

## Front

*The medium*

Every card is made to outlive this website — and turns with a click.

## Back

- **lead:** No menu, no tree. The almanac is dissolved into loose cards that wander and connect.
- **items:** [{"term":"Card","def":"The atom. One thing with its own DNA and its own number: verifiable, made to outlive this website — on paper, in a QR, on any domain."},{"term":"World","def":"Where a card comes from. Its language, colour, type and mark."},{"term":"Family","def":"Cards that grow together inside a world. Never finished."},{"term":"Set","def":"A bounded edition. Complete when every card is there."},{"term":"Stack","def":"Cards in an order that carries meaning: a lesson, a recipe, a route."},{"term":"Deck","def":"A free selection for one purpose. No order of its own."}]

## Body

What Eo Ena Cards are: the medium of the almanac, explained in four terms.

## Relations

- tp:systems: topic
- [Eo Ena](https://eoena.com/): world
- [image](https://tumblecard.com/eoena-cards-tttgattagctcatgatgaggatacagaagtctgagacgtaaacgcttgatctgacatccaata/assets/cards/eoe-hero-cards.webp): card illustration

## Source

- **Canonical:** https://tumblecard.com/eoena-cards-tttgattagctcatgatgaggatacagaagtctgagacgtaaacgcttgatctgacatccaata/
- **All cards on this site:** https://tumblecard.com/llms.txt

The canonical HTML page and card.json are the authoritative representations.
